Sökresultat

40 år och dement – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök 40 år och dement 2015-03-11 ⚠️ Den här artikeln är mer än 5 år gammal. Nya forskningsrön kan ha tillkommit. Tema: Demens De allra flesta som får en demensdiagnos är äldre, dvs. över 65 år, men även yngre kan drabbas. Sjukdome

https://www.vetenskaphalsa.se/40-ar-och-dement/ - 2026-06-05

Department of Arts and Cultural Sciences Division of Ethnology COURSE LITERATURE SASH86: Food, tradition and innovation, 7,5 credits SPRING 2025 Approved by the Department of Arts and Cultural Sciences Reviderad och granskad av kursplanegruppen All the literature is mandatory Belasco, Warren (2008): Food . The Key Concepts. Oxford: Berg. ISBN: 97818452067341, (158 pages) (Available at the LUX libr

https://www.ht.lu.se/media/utbildning/dokument/kurser/SASH86/20251/SASH86_Literature_VT2025.docx - 2026-05-28

Salary criteria at Linköping University 2024-10-21 DNR LiU-2024-04932 1(2) LINKÖPINGS UNIVERSITET Salary criteria at Linköping University Introduction The basic expectations on employees are that they are representatives of Linköping University (LiU), work according to LiU’s fundamental values and follow their employment contract. In addition to this, an assessment of employee performance and resu

https://www.saco.se/globalassets/lokala-akademikerforeningar/statlig/linkopings-universitet-liu/dokument/salary-criteria-at-linkoping-university.pdf - 2026-06-02

Alla nyheter – Sida 13 – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Tjejer får oftare tandställning än killar 2024-11-15 Bettavvikelser är vanligt bland barn och unga, men långt ifrån alla med besvär får kostnadsfri regleringsvård. Kön, socioekonomiska och var du bor kan påverka vem som

https://www.vetenskaphalsa.se/alla-nyheter/page/13/ - 2026-06-02

AVTAL Vatten och miljö 2025 Innehåll Förord ......................................................................................................................................... 4 Definitioner ................................................................................................................................ 5 Förkortningar ..........................................................

https://www.saco.se/globalassets/lokala-akademikerforeningar/kommun-och-region/akademikeralliansen/dokument/avtal-stadgar-pension/bok-2025/avtal-bok-25---vatten-och-miljo.pdf - 2026-06-02

Feature – Sida 25 – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Kategori: Feature Björn Slaug: Tillgänglighet och miljöfällor i fokus 2012-05-31   Foto: Dreamstime Ett unikt redskap för att hitta de 60 värsta miljöfällorna i hemmet för äldre och personer med funktionsnedsättningar. Som k

https://www.vetenskaphalsa.se/kategori/feature/page/25/ - 2026-06-02

This study explores the roles of genetic variation and phenotypic plasticity for explaining patterns of local wing colour variation in the common blue butterfly, Polyommatus icarus. Polyommatus icarus is one of the most widespread species of butterflies in Europe. Across its range, the female varies a lot in its dorsal colour, from all brown to almost totally blue. It has been suggested that, in S

Predation is an important ecological process that can significantly impact the maintenance of ecosystem services. In arctic environments, the relative ecological importance of predation is thought to be increasing due to climate change, partly because of increased productivity with rising temperatures. Therefore, understanding predator-prey interactions in arctic ecosystems is vital for the sustai

Molnens roll i klimatsystemet har studerats och deras påverkan på solens inverkan på jordens energibalans. Jordens albedo påverkar energibalansen genom att den påverkar hur mycket av solens instrålning som reflekteras eller absorberas. Moln påverkar jordens albedo och spelar därför en viktig roll i denna balans. Molnbildning sker till nära 100% i troposfären och där finns allt det vi kallar väder.The role of clouds in the climate system has been studied and their impact on the Sun's impact on the Earth's energy balance. The Earth's albedo affects the energy balance by influencing how much of the Sun’s radiation is reflected or absorbed. Clouds affect the Earth's albedo and therefore play an important role in this balance. Cloud formation occurs almost 100% in the tropospher

Cytological analysis of a series of Streptomyces coelicolor A3(2) mutants with disruptions of early sporulation (whi, for white aerial mycelium) genes in an isogenic background has provided new information about the role of whiH, and confirmed and extended previous knowledge about whiG, whiA and whiB. The characteristic straight aerial hyphae of whiG mutants contained normally spaced vegetative-li

This thesis is about materiality in archival pedagogy. More specifically, it is about how the archival educator composes educational material from the sources stored in the archives. The study focuses on the different ways and methods used by archival educators to translate the sources, making them comprehensible and interesting to a wider audience. The empirical data has been gathered using three

Amelogenin is a protein which has been found to have many interesting properties. Its biological function is a key part in organizing the crystals of the enamel and it has been found to have a clinical use for periodontal regeneration. Its self-assembling properties also makes amelogenin a suitable material for the fabrication of biomaterials. The aim of this project is to investigate the possibil

Episodic memory retrieval is associated with the holistic neocortical reinstatement of all event information, an effect driven by hippocampal pattern completion. However, whether holistic reinstatement occurs, and whether hippocampal pattern completion continues to drive reinstatement, after a period of consolidation is unclear. Theories of systems consolidation predict either a time-variant or ti

With the rise of the COVID-19 pandemic across the globe, people have come to understand the requirement of sanitation. However, other than the personal hygiene, sanitization of all the appliances (like mobile phone, wristwatch, wallet, eye wear, etc.) has become very important. Therefore, the requirement of germicides is being increased to sanitize all the appliances. A few germicides comprise che

Delirium is a serious and common condition in the intensive care unit (ICU), which affects 30-50 % of the patients and is associated with increased mortality and morbidity in the context of long-term outcomes. No evidence-based treatment for delirium exists, and currently, delirium is mainly treated pharmacologically with haloperidol, a typical antipsychotic agent. The “Agents Intervening against

Despite the critical role of microorganisms in plant and fungal residue decomposition, our understanding of their full diversity remains limited. This is due largely to the rapid microbial succession during decomposition, a scarcity of studies including multiple sampling times, and the omission of a species richness index encompassing all decay stages. To address these gaps, we conducted a meta-an

Birgitta of Sweden (Birgitta Birgersdotter, 1302/03-1373) and her younger contemporary Catherine of Siena (Caterina Benincasa, 1347-1380) form the most powerful and influential female duo in European history. Both enjoyed saintly reputations in life, while acting as the charismatic leaders of a considerable group of followers consisting of clergy as well as mighty secular men and women. They are a

Popular Abstract in Swedish Datorbaserade beräknings- och simuleringsmodeller har under de senaste två decennierna kommit att utgöra ett viktigt verktyg i industriella produktutvecklingsprocesser. Med sådana modeller och metoder kan utvecklingstiden kortas och kostnaderna minskas, till exempel genom att färre prototyper behöver framställas och genom att mängden kostsam provning kan reduceras. Bra With an increasing demand to improve efficiency and to cut costs, the industry is constantly seeking to reduce the time and money spent in product development and manufacturing. Use of computer-based simulations has become more or less a standard tool to meet this demand. Cost reduction is in this way made possible by for example shortened product development cycles, less need for expensive protot

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti